Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY115
Clone ID RRY115
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY115
Sequence
TCATGCAGAGATTACCCGACTCCTGCTTGAGGGAATCAGCAGTACACACGCCCATCATCTCCGCTGTCTGAATGACTTTG
TAGAAGCCCAGATGACTTACTATGCACAGTGTTACCAGTATATGCTAGACCTACAGAAGCAACTGGGA
Sequence Type mRNA
Unitrap ID UNI7044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 144359820..144360390 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037062 (Sh3glb1) NM_019464 SH3-domain GRB2-like B1 (endophilin) Gene [Source:MGI Symbol;Acc:MGI:1859730]

 
Come back to gene ENSMUSG00000037062


For any suggestions or comments, please send an email to unitrap@crg.es