Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST163956
Clone ID OST163956
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST163956
Sequence
CTGTTTCCAAGAAATTGACACAGTAAGTTATTCCTAAAGCCAAGAGCCATGTGACTATCCGGCGGGCTGTTTTAGAGGAN
NNNGGAAATAAAGTTAGAANCAGAACCACTCAGGTGGCGAAGAAACCTCAGAACACCAAAGTACCAGCTCTGCCCACCAA
AGTGACAAATGTCAACAAGCAGCCGAAACCCACAGCCTCTGTGAAACCAGTGCAGATGGAGGNNCTAGCTCCCAGGGNNN
GTCCTCCCGCCCCTGAGGATGTCTCCATGAAGGAAGAGAGCCTCTGCCAAGCTTTCTCTGATGCTCTGCTCTGCNAGATC
GAGGACATAGATAACGAGGACAGGGAGAACCCTCANCTNTGNNGTGNCTACGGTGGAAGGACATNTACCANTACNCTCAN
GNCAGCTTGAGGGTTTTACNGNCCNTTAATCCCCNCTNCTTTAGGATGGNAAGAGATATAAATGGAC
Sequence Type mRNA
Unitrap ID UNI23097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70260756..70266928 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032218 (Ccnb2) NM_007630 cyclin B2 Gene [Source:MGI Symbol;Acc:MGI:88311]

 
Come back to gene ENSMUSG00000032218


For any suggestions or comments, please send an email to unitrap@crg.es