Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY061
Clone ID RRY061
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY061
Sequence
CAAAGTGGCTCACCATGGGGAGAATCCTGTGAGCTGTCCAGAGCTTGTACAGCAGTTAAGGGAAAAGAATTTTGAGGAAT
TTTCCAAGCATCTTAAGG
Sequence Type mRNA
Unitrap ID UNI7049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98034569..98041361 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es