Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY476
Clone ID RRY476
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY476
Sequence
GGGGAACTGGAACCATCTGATGAAGAATCCTCAGAAGAGGAGGAGGAGGAGGAAAGCGATGAAGACAAGCCAGATGAGAC
TGGCTTCATCACACCTGCAGACAGCGGCCTCATCACTCCCGGAGGATTCTCATCCGTGCCAGCTGGGATGGAGACCCCTG
AACTCATTGAGCTGAGGAAGAAGAAGATCGAAGAGGCGATGGATG
Sequence Type mRNA
Unitrap ID UNI7053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5279270..5279573 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024853 (Sf3b2) NM_030109 splicing factor 3b, subunit 2 Gene [Source:MGI Symbol;Acc:MGI:2441856]

 
Come back to gene ENSMUSG00000024853


For any suggestions or comments, please send an email to unitrap@crg.es