Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRY010
Clone ID RRY010
Vector pGT2Lxf
Project baygenomics

Sequence tag RRY010
Sequence
CAGAGCAGAGCAGGAGGAAGCAACGGCCACAGACACATCGGAACCGAGAGTCTTAGTCGGGGGATCCGCGCGGCGGAGGC
GGACACCATGGGCAACCGCGGGATGGAAGAGCTCATCCCGCTGGTTAACAAGCTGCAGGACGCCTTCAGCTCCATCGGTC
AGAGCTGCCACCTGGACCTGCCGCAGATCGCCGTGGTGGGCGGCCAGAGCGCCGGCAAAAGTTCGGTGCTCGAGAACTTC
GTGGGCCGGTC
Sequence Type mRNA
Unitrap ID UNI909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21229453..21229702 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es