Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0210
Clone ID DB0210
Vector pGT1lxr
Project sanger

Sequence tag DB0210
Sequence
GGCAGCTCATTAAATCCCAGCGTGTGCAGAACAAGCTGGGTGTTGTGTTTGAAAAGGAGAAAGATCGGACCCAGCGCAAG
GACTTCATCTTTGTCAGTGCCCGGAAACGAGAAGCCTTCTGCCAGCTCCTGCAGCTCATGAAGAACAGGCACTCCAAGCA
GGACGAGCCCGACATGATCTCTGTCTTCATAGGCACCTGGAACATGGGAAGTGTACCACCACCCAAAAACGTGACATCTT
GGTTCACATCAAAGGGACTGGGGAAAGCTCTGGATGAGGTCACAGTGACTATACCCCACGATATCTATGTCTTTGGGACT
CAGGAGAACTCAGTGGGTGACAGAGAGTGGCTGGATCTGCTGCGTGGGGGCCTCAAGGAGCTTACAGATCTGGATTACCG
TCCGATTGCTATGCAGTCACTATGGAACATCAAGGTGGCTGTGTTGGTCAAGCCAGAACATGAGAATCGCATCAGCCACG
TCAGTACGTCCAGTGTGAAGACTGGTATCGCCAACACCCTGG
Sequence Type mRNA
Unitrap ID UNI706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 108978567..108979984 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032737 (Inppl1) NM_010567 inositol polyphosphate phosphatase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1333787]

 
Come back to gene ENSMUSG00000032737


For any suggestions or comments, please send an email to unitrap@crg.es