Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ059
Clone ID RRZ059
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ059
Sequence
GGTCTGATTTGTTTTAATCTCTGCTGCCAGGGGCCTTAGGGAATTGCCAGCGATCTACGACGTGGCGACATGAATGCAGT
GACTTATGAGGACCTGCATGTGAACTTCACTCAAGAGGAGTGGGCTCTGCTGGATCCTTCCCAGAAGAAGCTCTACAAAG
ATGTCATGGTGGAGACCTACAGGAACCTCAATGCTATAGGCTTTAATTGGGAAGCCCATAATATCGAAGAA
Sequence Type mRNA
Unitrap ID UNI7061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62558076..62568138 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055228 (8430426H19Rik) NM_178875 RIKEN cDNA 8430426H19 gene Gene [Source:MGI Symbol;Acc:MGI:1918758]

 
Come back to gene ENSMUSG00000055228


For any suggestions or comments, please send an email to unitrap@crg.es