Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRZ074
Clone ID RRZ074
Vector pGT2Lxf
Project baygenomics

Sequence tag RRZ074
Sequence
GGCAGTGCGGCGGGAAAGCCTCTGCAAGTGCGTCCAACATGGCGTCGGAGCGCAAGACTAAGTTATCCAAGAACCTGCTG
CGCATGAAGTTCATGCAAAGAGGCCTGGACTCGGAAACCAAGAAACAGCTAGAAGAGGAGGAGCGGAAGATGATCAGCGA
CGAGCACTGG
Sequence Type mRNA
Unitrap ID UNI7064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 120322976..120325839 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031843 (Mphosph6) NM_026758 M phase phosphoprotein 6 Gene [Source:MGI Symbol;Acc:MGI:1915783]

 
Come back to gene ENSMUSG00000031843


For any suggestions or comments, please send an email to unitrap@crg.es