Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST161051
Clone ID OST161051
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST161051
Sequence
ACTGAGGACAAAGGATGAAACTGAAAAGCTGCTCGTGTGTGAACGCTGGGATTTCCTGTGCAAACAGGAGATGGTAGGGG
AAGAGGGAGCCTTTGTGATAGGTTGTGAGGAGGTGCTGACTGAAGAGGAGCTAGCCACCACACTGAAGGTACTGTGCATG
CCTGCTGAGGAGTTCAGAGACTATAAAGAGCGGGCTGGATGGGGAGAGGAGGAGACAGAAGACGACAGTTTGGCAATCAC
AGATATCCCCAAGCTCCAAGAATCATGGAAACGGCTTCTTCGAAACAGTGTTCTGTTGACCCTACAGACCTACACCACAG
ACTTAAAAACAGACCAGGACTTACTCAGTAATAAGGAGGCCTATGCCACGCTGAGCTGGCGCGAACAACAAGCCTTACAG
GTCCGCTATGGTCANAAGANGATCTTACATTCGGNTGTTGGAACTCACAAATTAANCAGGCTTCCTGAGAACCTTTTAAG
GNCATGTTCTGTTGCTTG
Sequence Type mRNA
Unitrap ID UNI19165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98242095..98242724 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031671 (Setd6) NM_001035123 SET domain containing 6 Gene [Source:MGI (curated);Acc:Setd6-001]

 
Come back to gene ENSMUSG00000031671


For any suggestions or comments, please send an email to unitrap@crg.es