Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST160955
Clone ID OST160955
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST160955
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGGTCACCACTGGACATATGAAGGTGAGATTGGAACTGCACATGGA
TTGGCACTCCTTTCACCCCAGGACCTCCGCACCTGGCATGAAGACTTGTCCTGGGGGAGGGAAAGAGCTTTTCCTGAGCT
TCACCCACTAGCTCCTCTTTTTCTCCCTACACACACAGACCCTGGGGCTTACACAAGTGGCTGCTAGACCCTGCTGTAAT
CATTAAATCCCACATCTCCTGATTCAGCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95705817..95706056 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038526 (Car14) NM_011797 carbonic anhydrase 14 Gene [Source:MGI (curated);Acc:Car14-001]

 
Come back to gene ENSMUSG00000038526


For any suggestions or comments, please send an email to unitrap@crg.es