Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST160865
Clone ID OST160865
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST160865
Sequence
GACTGAGGATAAAAAGAGCAAGTGGTATGAGCAGCCTCTTAGGGAAAATTGGAGCCAAAAAACAGAAGATGAGCACCCTT
GAGAAATCCAAACTGGACTGGGAGAGCTTCAAGGAAGAAGAGGGGATTGGTGAAGAACTGGCCATCCATAACCGAGGGAA
AGAAGGGTACATTGAGCCGGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGATCTCAGGCTG
AGCAAAATGAAACCTTGACATTNTGGGAAGGATTCCTAGCAGCTGAATCCTATTGACAATGTGAGCTCCTCTGAGTGTCT
GTGAAATACTTCCAGNGTTCCTCATCATGTTTCCAGCAAGNCCCTTTTTNTACGTTGCAGTTTGTTTAATGTATGTTAAT
TTCACCTGGCTTCATTCATTTTCCTTTTTAAAANTTGTCTTTTAAATAAACAAACAGAACCCTCTGTAA
Sequence Type mRNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292388..114303311 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es