Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST160117
Clone ID OST160117
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST160117
Sequence
GACTGAGACAGATGCTCCAAGTCCCCTGCNGTTCTCTTCGAAAGAAGACGAGGAGTGCGAAAATA
Sequence Type mRNA
Unitrap ID UNI25831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95610312..95610365 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075595 (Zfp652) NM_201609 zinc finger protein 652 Gene [Source:MGI (curated);Acc:Zfp652-001]

 
Come back to gene ENSMUSG00000075595


For any suggestions or comments, please send an email to unitrap@crg.es