Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST159950
Clone ID OST159950
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST159950
Sequence
GTCCCTTGAGGGTAACNGCACNCTGTAGGTCGTACTTATNAGCACNCACTNTCNTTNNTGAGATGGNCCTTCTCCCGGGN
GCNAGTGAGGANCATAGNTNNACNNCNNCTTGAGATNNCACATCAGGGTNTCAGCTCTGGACTTAATGCAGGTAGCTCCA
CTGCTTTCTTCAGGACGGCACAAAGACCGTTGAGTATGCTCCATGCAGGTCAAGTATGTATGAAANGCTGCACCTTCTCT
TAACAAGAGACCCTAGGAGCCTAGTTTTTGTGTGAGATGCATGTGNGTGTCTGTATGACAAATTGTGNGGACATTGNGAG
GNTAATAGAGCAAAATGACCTAACTCTGCTCATACAAAGAAATTACAAATGNGAATTGACCATGTTTCTA
Sequence Type mRNA
Unitrap ID UNI25832

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 83596025..83596254 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027087 (Itgav) NP_032428 integrin alpha V Gene [Source:MGI (curated);Acc:Itgav-005]

 
Come back to gene ENSMUSG00000027087


For any suggestions or comments, please send an email to unitrap@crg.es