Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF190
Clone ID RRF190
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF190
Sequence
ACGTGACGGGCGGCGGGGCGCAGGCACCCAGGCTGGGAGTTCTTCTGAGGGAAAGCCGAGTGGAGTGGGCGACCCGGCGG
CGGTGACAATGAGTTTTCTTGGAGGCTTTTTTGGTCCCATTTGTGAGATTGATGTTGCCCTTAATGATGGGGAAACCAGG
AAAATGGCAGCAATGAAAACTGAGGATGGCAAAGTAGAAAAACACTATCTCTTATATGATGGCGAGTCTGTGTGCAGGAA
Sequence Type mRNA
Unitrap ID UNI1764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61943308..61949496 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020078 (Vps26a) NM_133672 vacuolar protein sorting 26 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1353654]

 
Come back to gene ENSMUSG00000020078


For any suggestions or comments, please send an email to unitrap@crg.es