Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST159595
Clone ID OST159595
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST159595
Sequence
CTCCGTCTGGAGACGAACCAAACAGCTGCGGATGCCGAATGAAGTCACAAGCACAGACACAATCCGAGCTCTCTTCGTCA
GTGCCTTTCCCCAGCAGCTCACCATGAAGATGCTGGAGTCGCCCAGTGTTGCCATCTACATCAAGGATGACAGCAGAAAT
GTCTACTATGAGTTAAATGATGTGAGGAATATCCAAGACAGATCCCTTTTCAAAGTATACAACAAGGATCCTTCACATGC
ATTTAACCACATGACGAAAGCCGTGAACGGAGACATGAGGATGCAGAGAGAAATTGTTTATGCAAGAGGAGATGGNCTTG
NTGCCCCCCGACCAGGATCTGTGGCTCACCCACCTNATGGTAATTCCAAACTCCCCCACCATTGNACTCCGGTGCCCCAT
TNCTTACCTGNCCTCTCCATCCAGAAATT
Sequence Type mRNA
Unitrap ID UNI2242

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20631043..20665227 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es