Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF276
Clone ID RRF276
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF276
Sequence
CCTGGGGAATATTCCTATTTCAGTCCCCGGACCATGAAGATGTGGGCTGGCCCAGATCACTGGCGCTTCAGGCCTCGACC
CAAGCAAGATGCTACCTCCTGCACAGAGCACAAAAAGAAGAGTGCAAAGAAAGACTTTGAAATTAATTTTGATGATGATA
TTGATTTTGATGCATATTTTCAGAAAACAAAGGCTGCTACCATTCTGACCAAGTCCACTTTGGAGAACCAGAATTGGAAA
GCCACCACTCTTCCCACAGATTTCCACTATGAAACTGATAATCTGATCCAGCTTCACCTCAAACCAGGCAAAAGGTCACT
TAAGATGGACCAGGACCAGAAGGCTAAGACTGAGCACTATGAGGAAATTGAAGACTATGATTACAACAACCCTAACGACA
CCTCCAACTATTGTCCTGGACTT
Sequence Type mRNA
Unitrap ID UNI3802

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126939299..126943897 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034906 (Ncaph) NM_144818 non-SMC condensin I complex, subunit H Gene [Source:MGI (curated);Acc:Ncaph-001]

 
Come back to gene ENSMUSG00000034906


For any suggestions or comments, please send an email to unitrap@crg.es