Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST158851
Clone ID OST158851
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST158851
Sequence
AGACTGAGGATGCAGATTTCCAGGCNGTCCTGAGGAGCCCTCCATTGTGTTGGAAAAGCTTCGAGAACTCAGTTTTAGTG
NCATCCCCTGTGAGGGCGGACTGCGGTGCCTCTGCTGGAAGATCCTCCTGAACTACCTCCCTCTGGAGAGAGCCTCGTGG
ACTTCCATCCTGGCCAAGCAGAGGGGGCTCTATTCGCAGTTCCTNGAGAGAGATGATTATCCAGCCTGGCATTGCCAAGG
CCAACATGGGTGTATTCAGGGAGGATG
Sequence Type mRNA
Unitrap ID UNI25838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29990315..29992884 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039678 (Tbc1d13) NM_146252 TBC1 domain family, member 13 Gene [Source:MGI (curated);Acc:Tbc1d13-001]

 
Come back to gene ENSMUSG00000039678


For any suggestions or comments, please send an email to unitrap@crg.es