Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ340
Clone ID RRJ340
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ340
Sequence
GGGGCTAGGGCCGCCCTTCGCGGGCGCGCCCTTCTCCATTCTCTAGGTGTTCCCGGAGCGCCTTGGCTTCTGCCAGCACC
ACGACGATG
Sequence Type mRNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114471425..114471513 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es