Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST158260
Clone ID OST158260
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST158260
Sequence
ATCATCTCTGACAATCCTGTTGTAACTGCCATATGACACTTGTTGGGATTCAACCTTCTTGATATTCATATGCTCANCCA
TATNTGCATAACTGTAAATCAACACTAAGAGCAGNGGAAGGTTANAGGTAAAGGANAGTCTCACAAAGGATCCAGGAAAT
CATTGCATATA
Sequence Type mRNA
Unitrap ID UNI25847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 145002089..145039385 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082082 (AL606963.5)  

 
Come back to gene ENSMUSG00000082082


For any suggestions or comments, please send an email to unitrap@crg.es