Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0141
Clone ID DB0141
Vector pGT1lxr
Project sanger

Sequence tag DB0141
Sequence
ATCCAGCACCAGAGGCAGGCATTATGTGCATGAGTTTGAGGCCAGCGTGGCCTACAGAGTTACCTATAGCACAGTGCCAG
CTTCTCTTTTGTTTTTCAGAGAAAATAAAGTATTTTTCATACAACATGTTCAGATCATGGGTTCCGCTCCCTCCATCTCC
TGCATGGGTCTACGACCAATTCCCAGGGGGCGGGGCGGCCGAGGAGGCGTTGGCAGCGGGCTCGGACCCACGCGGCGCTG
CGGCCCGCCTGGCCTGCAACGCTCCCACCGGCTCGGCGGCACGATGCCCTTTGACTTCAGGAGGTTTGACATCTACAGGA
AGGTGCCCAAGGACCTCACACAGCCGACATATACTGGTGCCATTA
Sequence Type mRNA
Unitrap ID UNI713

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26698460..26745599 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]

 
Come back to gene ENSMUSG00000001576


For any suggestions or comments, please send an email to unitrap@crg.es