Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST158250
Clone ID OST158250
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST158250
Sequence
TGAGCCTCAGAGCGCCGCCTGAAGCCTTGGCTAGTAGGCCTGGCTGCAGTAGTGGGCTTCCTGTTTATAGTCTTCATCCT
CATGCTGGCCAATCGTGTCTGGTGCGCCAAAGGCAGAGCAGAGGATGAGGAGGCTACATTCAGAATGGAGCACATTATGA
ACGAGAACTCACAGCCAAGTAAAGCAGACAAGAAGCAGAAGAAGAAGGTGGACAGGAAGGGCGGACAGAGCAACGAGGCC
TTGGAACTAGAGGAAAAGGAGTCCTCAGATGAGGAGAGAGGCAAGAAAACAGCTTTGTAAAGCATCTTGTCACCTGGGGG
TGCTTCATCCACACACCTCAAGTTGCAGCCACCACCTGAAGCCGGACTGGTGTCATCTGGGTCTGAAAACTGTCCTCATA
TGAGGAGGTCAGCTCTGCCTATGGCCTCCATACTCACCCCCACCTTCCCCTGACACTCACCACTGGCCTGGTGTCCACTC
CTATTCATCTGTCCCCCTTCTGCATCCTCTT
Sequence Type mRNA
Unitrap ID UNI25848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80856527..80857851 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078439 (2210404O07Rik) NM_001099917 RIKEN cDNA 2210404O07 gene Gene [Source:MGI Symbol;Acc:MGI:1919523]

 
Come back to gene ENSMUSG00000078439


For any suggestions or comments, please send an email to unitrap@crg.es