Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST158188
Clone ID OST158188
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST158188
Sequence
CCACCTCCCACAACCCTGGGGTTCCAGGGGAGCAGGGTAGCGGGGAATGCCTCCTGACTGTGGCCCTGGCAGGTGCTCCC
TACCAAGCCGTGGGCTTGGTCCAGGGCACCACACCAATGCTGCAGATGCTCAACGGAGCTGTCTTCAGACCAGAGGTGCC
ACTACGCAGGGGCCAACCCCTGCTCGTATTCCGGGCTCAGCCCTCCGACCCTGGGATGCTGCCCACTATGATTGGCCTCC
TGGCAGAGGCGGGTGTACAGCTGCTGTCCTACCAAACCTCCATGGTGTCTGACGGAGAGCCCTGGCACGTCATGGGCCTG
TCCTCCCTGCTGCCCAGCCTGGAAACATGGAAGCAGCATGTATTGGAGGCTTTCCAGTTCTGCTTCTGACCCTGGGGTTC
AGCACTCTCAGCCCCACAGGCTCTTCTGAAGAAACCCGCTCAACTGTGACCTATAGGGAGAGGGGATCGCANAACCAGGG
CATNTGCCTGAACTAATACCTA
Sequence Type mRNA
Unitrap ID UNI25849

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 98117113..98118324 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053398 (Phgdh) NM_016966 3-phosphoglycerate dehydrogenase Gene [Source:MGI (curated);Acc:Phgdh-001]

 
Come back to gene ENSMUSG00000053398


For any suggestions or comments, please send an email to unitrap@crg.es