Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ463
Clone ID RRJ463
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ463
Sequence
CCAGTCGCGCGTGGGCTGAGGCCCTGGGCGGGCGTTGCGAAGACTTGTTTGCTTGAGTTTGGACCCTGCGACAGTTCTCA
TTTCCCTCCCGGTGGGGCTGGCGTACACCCGGAGCTGGAGAATGGGCAGCTAGACGCAGGCTAGGGAGCCTGTGGCTGCG
GACATGAACTCGCCCGTGGACCCCGGCGCTCGGCAGGCACTGAGGAAGAAGCCGCCCGAGCGGACTCCTGAGGACTTAAA
TATTATTTATTCTTATCTGCATGGGATGGAAATACTATCAAACCTCAGGGAGCATCAGCTTAGGTTAATGTCTACAAGAG
CACGCTATGAGAGATACAGTGGCAATCAAATGCTTTTTTGTTCAGAAACTATTGCCAGATGTTGGTATATCCTGCTTTCT
GGATCTGTACTTGTAAAAGATTCTATGGTCCTTCCTCCTTGCAGTTTTGGTAAGCAGTTTGGAGGAAAAAGAGGATGTGA
TTGTCTTGTGTTAGAACCTTCAGAAATGATTGTGGTAGAGAATTCCAAAGATAATGAAGACAGTATTTTACAAAGAGAAA
TTCCTGCCAGACAGTCTCGACGAAGGTTTCGGAAAATTAACTATAAAGGAGAACGCCAAACCATAATAGATGGAGTGGAT
ATTAATAACTACCTTTC
Sequence Type mRNA
Unitrap ID UNI7121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54336389..54381997 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037533 (Rapgef6) NM_175258 Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Rapgef6-003]

 
Come back to gene ENSMUSG00000037533


For any suggestions or comments, please send an email to unitrap@crg.es