Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ519
Clone ID RRJ519
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ519
Sequence
AGGTGCAGTATCAGAGACTGATGGTCAAAGTGGAGGACATGTAGAGAAACATCTTCAGCAAGGACAACACAGTGCATGAC
CTGCGGCAGCAGATGACAGCGTTACAGAGCCAGCTCCAGCAAGTACAGCTGGAGCGCACAACCCTGACCAGCAAACTACA
AGCATCACAGGCTGAGATCACGTCTCTGCAGCATGCCCGGCAATGGTACCAACAGCAGCTTACTTTGGCCCAGGAGGCCA
GGGTCAGGCTGCAAGGAGAGATGGCCCATATCCAGGTTGGACAAATGACCCAGGCAGGCCTTTTGGAGCACCTGAAGCTT
GAGAATGTGTCCCTATCGCATCAGCTGACAGAAACTCAGCATCGATCCATCAAGGAGAAAGAGCGCATAGCTGTTCAGCT
CCAGAGCATTG
Sequence Type mRNA
Unitrap ID UNI7134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110618860..110622773 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029502 (Golga3) NM_008146 golgi autoantigen, golgin subfamily a, 3 Gene [Source:MGI (curated);Acc:Golga3-001]

 
Come back to gene ENSMUSG00000029502


For any suggestions or comments, please send an email to unitrap@crg.es