Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST157146
Clone ID OST157146
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST157146
Sequence
CTGAGCTGGAAGTGCTGTGTACTCATGCTCTACNTAGGGACCGATCTCACTGAAAGAGTAGAGGCTGAGANNGCACTCTN
GGAACATGATTGACAGCCCAGAATGTCTCAGCAAGTGTCAACTTTTACTAGAACAAGGAACANCATCCTATGCTCAGCTC
CTTGCAGCAACATGTCTTTCANAACTTGNTACCCGAATCAATCCTTTACCTATTGAACAGAGGATAGACATCAGAAACTA
CATCCTGAATTATGTGGCGTCCCAACCTAAGCTGGCGCCCTTTGTCATCCAAGCTCTGATTCAAGTCATCGCTAAACTCA
CCAAGTTGGGGTGGTTTGAGGTGCA
Sequence Type mRNA
Unitrap ID UNI25861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33393306..33404821 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es