Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0114
Clone ID DB0114
Vector pGT1lxr
Project sanger

Sequence tag DB0114
Sequence
AGGACCACAGGGACCCCCAGGACCAGCCTGCCCCACTTCCACCACCCTGAGACTACCCGCCCAGATTCCAACATCTACAA
GAAGCCACCCATCTACAAACAGAGAGAATCCGTGGGAGGCAGCCCTCAGAGCAAGCACCTCATCGAGGACTTCATCATCG
AATCCTCCAAGTTTCCTGCAGCGCAGCCACCTGACCCCAACCAGCCAGCCAAGATAGAGACTGACTACTGGCCATGTCCC
CCGTCACTGGCCGTTGTGGAGACAGAATGGAGGAAACGGAAGGCATCTCGAAAGGGGGCAGAGGAAGAGGAGGAAGAGGA
AGACGATGACTCTGAAGAGGAGATTAAGGCCATCAGGGAACGGCAGAAAGAGGAGCTCAGTAAGGTTACTTCCAACTTGG
GAAAGATGATCTTGAAAGAAGAGATGGAAAAGTCATTGCCCATCCGGAGGAAAACACGCTCTCTGCCTGACCGGACACCC
TTCCATACCT
Sequence Type mRNA
Unitrap ID UNI79

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71012475..71015469 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es