Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ579
Clone ID RRJ579
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ579
Sequence
ACAGCAAGTGGTCTTGCCCATCTTCACATGGAGATTGTTGGTACCCAAGGAAAACCAGCTATTGCCCATAGAGATTTGAA
ATCAAAGAATATCTTGGTGAAGAAAAATGGAACCTGTTGTATTGCAGACTTGGGACTTGCTGTGAGACATGATTCTGCCA
CAGATACAATTGATATTGCTCCAAACCACAGAGTAGGCACTAAAAGGTACATGGCCCCTGAAGTTCTAGATGATTCCATA
AATATGAAACATTTTGAATCCTTCAAACGCGCTGACATCTATGCAATGGGCTTAGTGTTCTGGGAAATTGCTCGACGCTG
TTCTATTGGTGGAATCCATGAAGACTATCAGTTGCCTTATTATGATCTTGTACCTTCTGATCCATCGGTTGAAGAAATGA
GAAAAGTAGTTTGCGAACAGAAGTTAAGGCCAAATATTCCAAACATGATGGCAGAGCTGTG
Sequence Type mRNA
Unitrap ID UNI7141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47415794..47419922 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007613 (Tgfbr1) NM_009370 transforming growth factor, beta receptor I Gene [Source:MGI (curated);Acc:Tgfbr1-001]

 
Come back to gene ENSMUSG00000007613


For any suggestions or comments, please send an email to unitrap@crg.es