Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ602
Clone ID RRJ602
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ602
Sequence
GCATGACGGCGGCATGAGCACGGACGGGGAGTCGCTTGAGGAGCCGAGGTGGAAGGCGGTGGCCTCACCCAAGGCGTCAA
CCATGCCCGAGAAGCGCGGGAGCGCTCAGGCCGCGAGCGGCAGCTG
Sequence Type mRNA
Unitrap ID UNI7145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 65213813..65213938 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038212 (Hiatl1) NP_001077370 hippocampus abundant transcript-like 1 Gene [Source:MGI Symbol;Acc:MGI:1913881]

 
Come back to gene ENSMUSG00000038212


For any suggestions or comments, please send an email to unitrap@crg.es