Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRS019
Clone ID RRS019
Vector pGT0Lxf
Project baygenomics

Sequence tag RRS019
Sequence
TTCGAGTGGACAAAATGGCGAAGATCGCCAAGACTCACGAAGTTC
Sequence Type mRNA
Unitrap ID UNI5576

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 55084183..55084224 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025982 (Sf3b1) NM_031179 splicing factor 3b, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1932339]

 
Come back to gene ENSMUSG00000025982


For any suggestions or comments, please send an email to unitrap@crg.es