Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST155197
Clone ID OST155197
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST155197
Sequence
ACTGAGGGGAACCTGCGACGAGTGGNTGTCCAGCTGTTGGGACAGCTGNGTGACCTGGGACTGGAGATGGNTACCTTTCG
GGAAGAGCTGGTCACTATCCTGGAAGAGGAGGAAGAGGAAGAGGAGCAGGAGGAGAAGAGCTGTGTTGAAGAGAACAAAG
GGCCCGAGGAGAAGCAGGACGAAGAACGTTCCCGGAGCTCCTATCCAGCCCAGCGCCTCCCTGACTTCGAGATGACCATC
TGAGGTCATTTAGCTTGACACGCAAATGAGATGCAAATTCATGCAAAGGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26400030..26400321 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074261 (EG632778) NM_001039243 predicted gene, EG632778 Gene [Source:MGI Symbol;Acc:MGI:3646269]

 
Come back to gene ENSMUSG00000074261


For any suggestions or comments, please send an email to unitrap@crg.es