Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST155089
Clone ID OST155089
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST155089
Sequence
CTATGCTCCTAGAGGAGATATCATGTGCTATTACACCCTCACTGAAAAGTTCATCCCTCGACGCAAGGACTGGATTGGCA
TCTTTAAAGTAGGGTGGAAGACCACTCAGGAGTATTATACCTTCATGTGGGCTCCCTTGCCAAAAGACCAAAACAAGGAT
TCAGCCACACAGCAGGAAATCCAATTCAAAGCTTATTACCTTCCCAAGGATGTGGAGCGCTACCAGTTCTGCTATGTGGA
TGAAGATGGTTTAGTCCGGGGAACAAGTGTCCCTTTCCAGTTTTGTCCAGACCCTGACGAGGACATAATGGTTGTTATCA
ATAAGGAAAAGGTAGAAGAGATGGAACAGCTCAGTGAGGAGCTTTACCAACAAAACCAGGAGCTGAAAGACAAGTACGCT
GACCTCCATGAGCAGCTACAGAGGAAG
Sequence Type mRNA
Unitrap ID UNI15585

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95963965..95968832 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006056 (Calcoco2) NP_084031 calcium binding and coiled-coil domain 2 Gene [Source:MGI (curated);Acc:Calcoco2-001]

 
Come back to gene ENSMUSG00000006056


For any suggestions or comments, please send an email to unitrap@crg.es