Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST155002
Clone ID OST155002
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST155002
Sequence
CAGAGGGACAACAGGAAGNAGGAAGGTGCTCANAAAAAGGCTGCTGATCAAAAAACCAAAGTAAATGCAGAATTGGTGGA
ACTACGGCTTTTGACCCTGTGTATCAGTCCTTGGTCCTTGTTACCAGAGTCACTTCAACAGATGAGTTTACTGTTAAATN
GGTATTGAAGCAGCAGGGTACCAGGTCATCTCCTCTGCTCTGTTAGAATCTTTTCAGAAGGCTCCAGAAGGACTGGCCAT
GGCTGTATTTGGATTTATGATTTCAAATAAAACAGTGTTTTTTACAAATAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117562106..117564579 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es