Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST154925
Clone ID OST154925
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST154925
Sequence
CTTCCCAGTGGCTCCAGAAGAATCANTCTCGAGTGTGTTTGGGATCAGAACAGACTGTTGGAGCGGACACAGCGCAGAGT
AGGAAATACCACAACACAAGTAAGCTTCTTACTACCCAAGATTTCCCACAGCCTGTTGNAGAGAAGGTCGGTCCCTTCAC
GAAGATAATAGAAGCCATGGGATTCACTGGACCTTTGAAATACAGNAAATGGAAGATCAAGATCGCGGCCCTCCGCATGT
ACACGAGCTGCGTGGAGAAGACTGACTTCGAGGAGT
Sequence Type mRNA
Unitrap ID UNI25882

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155735098..155737576 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005882 (Uqcc) NM_018888 ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI (curated);Acc:Uqcc-010]

 
Come back to gene ENSMUSG00000005882


For any suggestions or comments, please send an email to unitrap@crg.es