Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST154276
Clone ID OST154276
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST154276
Sequence
TGCCAGACTCTGGGCCACTCTGGCTGGCTACCAAGCGGCTCAAGATGTCTGCAGGGGCCAGTGCTACAGGGCCCAGGAGG
GGGCCGCCAGGACTGGAAGAGGCCACTAGTAAGAAGAAACAGAAGGATCGAGCAAACCTGGANGGGNGAGATGGAGATGC
TAGGAGAGTGTCCCTTCCTCGAAAGGAACCAACCAAAGATGAATTGTTGCTCGATTGGAGGCAGAGTGCAGATGAGGTGA
TTGTTAAGCTGCGCGTGGGAACAGGTCCCGTACGTCTGGAGGATGTAGATGCTGCGTTCACAGACACGGACTGTGTGGNG
AGGCTTCCAGATGGTCGG
Sequence Type mRNA
Unitrap ID UNI25890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108394895..108395598 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006676 (Usp19) NM_027804 ubiquitin specific peptidase 19 Gene [Source:MGI Symbol;Acc:MGI:1918722]

 
Come back to gene ENSMUSG00000006676


For any suggestions or comments, please send an email to unitrap@crg.es