Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST154265
Clone ID OST154265
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST154265
Sequence
CCCCAGGGGCATCCCGCTGGTCAGCCAGGGGCATTTTGAGAGGGTGTNTAAAACCAGATCCTCCCTGGTGGGGCAGCAGA
ACAAGCTGGAAAGCTGACAGAAGCTGTCTCTGCTTTTGGCAAAAAATTTTCCTCATTCTGGTGATTGTGTCCAGAAGGGC
TCCTGAAGACCTGAAGAAAGACAATCTCATTGNTNTGGAAAAATNNGNGGAGTCAAAGGCCTGGGCGCAGCTCTTGGACT
CTNNNTATAACGCATCTACAAGCTGGCAAACCTTTGGCCCAAAGATTCCCANCAGGCNGGCCCCCAGCAGGCAGGCCTCA
ACCAAGCATGAGAATGACATGTGTTCTCACAGCAGCTGACCTATNGTGAANCATCTGCCGGACCAATGGGACCATTGGCT
TGGGGGACCTTTCATTGTNTTTCAAGAGACCCTGCCTTAATCAAGGCCAGCCCGTCCTTGGGAAGCGAG
Sequence Type mRNA
Unitrap ID UNI17376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108002019..108006376 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032589 (Bsn) NM_007567 bassoon Gene [Source:MGI (curated);Acc:Bsn-001]

 
Come back to gene ENSMUSG00000032589


For any suggestions or comments, please send an email to unitrap@crg.es