Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU410
Clone ID RRU410
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU410
Sequence
GCCGAGCCGGCCGCCCCTCGCCCCTTCTCTCCAGCGTCGCCCGGTGTGGCTGGCGGCGCCCGCGCAGCCTCGGGCTTGGA
AGGGTGCAAGATGACCAACGAAGAACCTCTTCCTAAAAAGGTCCGACTGAGTGAAACAGACTTCAAAGTTATGGCACGGG
ATGAGTTAATTCTA
Sequence Type mRNA
Unitrap ID UNI7167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13176325..13185256 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es