Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST153978
Clone ID OST153978
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST153978
Sequence
GACTGAGGATACAATGCAACTGTCCTGGCCTATGGGCAGACTGGATCTGGAAAAACGTATTCAATGGGAGGTGCATACAC
TGCAGAACAAGAACATGACTCAGCCATTGGGGTTATTCCCAGGGTAATACAACTGCTCTTCAAAGAAATTAATAAAAAGA
GTGACTTCGAATTTACTA
Sequence Type mRNA
Unitrap ID UNI25894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97829176..97829347 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034311 (Kif4) NM_008446 kinesin family member 4 Gene [Source:MGI (curated);Acc:Kif4-001]

 
Come back to gene ENSMUSG00000034311


For any suggestions or comments, please send an email to unitrap@crg.es