Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU416
Clone ID RRU416
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU416
Sequence
ATCCCACACGTCTGAGGGACACCTTGGAGCCACGCCCTTTTTCGGCGCTCTTGGCCAGGCTGAACCAACTGTAGCAAGCT
TGGAGCCCGCCCCGCGGCTCGCGTGAAGAGAGCACCCTCCGGCTTCCAGCACTACTCCCTGCCTCCTAGCGGGCGGGACC
CTGAGACGCTTGCCTTTGAGTGGAAGGCGGGAGAATGGCGGATTCCTCAGAGCGGGACGCAGGGAAGTCTGCAGCTGCTG
GTGCTTGTGCTGTTCCCAAGACAAAGGGAAGGAGAGTGCAAGGAAGAAGAGTGGTGGAGTCCCGGTATCTGCAATATGAC
AAGAAAGCAAAAAAGGTCCCAAATCG
Sequence Type mRNA
Unitrap ID UNI7169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73786949..73796403 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035439 (2410004L22Rik) NM_029621 RIKEN cDNA 2410004L22 gene Gene [Source:MGI Symbol;Acc:MGI:1923728]

 
Come back to gene ENSMUSG00000035439


For any suggestions or comments, please send an email to unitrap@crg.es