Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU419
Clone ID RRU419
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU419
Sequence
GCTCACTGTCTCCAAGATGGCGGCCGTGTCAGTTTGGGGCATCTCCGCGGTCCGGCCCGGGCCCCCGGGATCCCGGCTGT
CTTCCCCCCAGGATTCTTCCTACTAATCCAGATACTTGTTGAAGTGCTGAATAGTTTCTTGGGGACAATGTGGAGGACGA
GTTGACCC
Sequence Type mRNA
Unitrap ID UNI7170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23970014..23972065 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031540 (Myst3) NM_001081149 MYST histone acetyltransferase (monocytic leukemia) 3 Gene [Source:MGI (curated);Acc:Myst3-002]

 
Come back to gene ENSMUSG00000031540


For any suggestions or comments, please send an email to unitrap@crg.es