Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST153793
Clone ID OST153793
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST153793
Sequence
ACTGAGGTTGCCTGCCAGCAGGNCAGCATGGCGGNTGGAGGGAGAGAAGGGCATCGAGGGAGATGAGAACTCACCTACCA
TCTGAAAGTCTTAAGGTTTGCTGACAGACAAAACCGGGCTTTGAATGGAGCGTGAACTCCTGAGGCGAGCATTGGCCCGA
GAGAGCCGAGGATGCANGTGTNGGTCTGATCTTGATTTTCAGGTACTTTTGGGAATACAGAATACCATTNTNTTGTTCCT
GCTGNCCAGCCCCACAAGGCTATGCAGAATGCAAAGAAGAGTTACTTTCTTGGCTGNGGAGTAGTGGCATCAT
Sequence Type mRNA
Unitrap ID UNI2523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166889134..166891293 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074578 (1500012F01Rik) NM_001081005 RIKEN cDNA 1500012F01 gene Gene [Source:MGI Symbol;Acc:MGI:1916199]

 
Come back to gene ENSMUSG00000074578


For any suggestions or comments, please send an email to unitrap@crg.es