Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST153522
Clone ID OST153522
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST153522
Sequence
GACTGAGGTGGGGTCTTTNCCTGGGGAATGTGTGCTTGCGCGGTTGCTGGAGTCGCGGTCTCTTCCCTGGTGGTTCCGAC
TGCGGAGAGCGGTGGAGATGAAGACGAAGGCCACCGNGCCTGGTGCCCCAACCTGGGCCTATCAGGAAGCTCGCTAGGAA
GAAAGCCAAGAAGAAGTTCAGGAAGAGCAAAGCTCTGGCAGGAAGTGGGGTTCCGGGAAGCCACCCGGCGGCTGTGGCAG
GCCGACCGCCGAAGGCCCCCGAGAACTTTTCTCANAATTGGAAGGCGTTGCAAGAGGTCTTCCTTAGATTCTGAGCTGTA
GCCGCCTCCAGAGATAACGGAAGTGATCACTGTGTCCCACAGTGTTGACCATGGAAGTCACTANGTGAAACTCCAAATAA
Sequence Type mRNA
Unitrap ID UNI25898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26818401..26819846 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052406 (Rexo4) NM_207234 REX4, RNA exonuclease 4 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rexo4-001]

 
Come back to gene ENSMUSG00000052406


For any suggestions or comments, please send an email to unitrap@crg.es