Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU439
Clone ID RRU439
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU439
Sequence
GGGTGTGGCCTCCATGGCGACTCCGCTGGTTCCCAGGCCGCGAGTCTCGCCCCGTTGCTTCTCAGAGGCTAGGGCCCTGC
ACTTCTCAGGTCCCGGCCGGGGGCCATTTCATCGGAACGATATTTGAGCTGTCTGTGCTTTTTTTTTTTGTCTTTTCTCG
GTCTCTTCCGGTGTGGCCTGGTGCGGCCCCTTTCTCTGTTTCTAGAAAGAAGGATTTCGGCCGTTGGAATCTGTCTTCGC
GCCCCATCGCTCCAGGAACCTGGCCATCCCGCTTCATTGTGAGCAGTGGGTGGAATTTGATGGAGCAGGAAAGTCCCAG
Sequence Type mRNA
Unitrap ID UNI3444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20263992..20264309 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063108 (Zfp26) NM_011753 zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]

 
Come back to gene ENSMUSG00000063108


For any suggestions or comments, please send an email to unitrap@crg.es