Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU446
Clone ID RRU446
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU446
Sequence
GGAGGCCGGAGCAGAGATTCGCGAGGGCGGTAGTCGACTGATGTGAGTGCTCTCGGCGAGGCCCAGGCAGCGGCGGCGGC
GGCGGCGGTTCCTCTCGGGTTACGGTGAAGAATGTCAGCCACTAGCGTGGATCAGAGACCTAAAGGGCAAGGAAATAAAG
TTTCAGTACAAAATGGTTCGATTCATCAAAAAGATGCTGTAAATGATGATGATTTTGAGCCATACTTAAGTAGCCAGACA
AAT
Sequence Type mRNA
Unitrap ID UNI7177

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16083386..16089560 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047213 (Ythdf3) NM_172677 YTH domain family 3 Gene [Source:MGI Symbol;Acc:MGI:1918850]

 
Come back to gene ENSMUSG00000047213


For any suggestions or comments, please send an email to unitrap@crg.es