Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST153144
Clone ID OST153144
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST153144
Sequence
CCTTAGGGGTGAGCAAGGAAAGTCAGAAACTAGATGTCCAGTCTCCACCGGAGTCTTTTCCCCTCCAGGGAGCCACCCAG
CCCTGCTGTTCAGCATTTCACCTTTGCCCTCACTGACCTGGTGGGCAACCGTAGATTTGGCTTCTGCCGCCTGCGAGCTG
GTGCACGGAGTTGTCTCTGTATCCTCAGCCACTTTCCCTGGTTNGAAGTGNTCTACAAGATTCTCAATAACGTGGGGGAC
CTTCTAGCCCAGAACCAAGTCGCCGAGGCTGAAGAACTCCTACAAAACCTACAGCAACACCCACTTCTTGGACCCCGGTT
TTCAGGAAGATCAGAGATGTTACTCTCGTCCCACAGGACAGCAGCATCACTGNCCGGAGNGAATGNGGAATCTTGCCTCC
TGCCCTGGGGAATAGCAAGCTGTTTCTTG
Sequence Type mRNA
Unitrap ID UNI25903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57213537..57214978 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002668 (Dennd1c) NM_153551 DENN/MADD domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918035]

 
Come back to gene ENSMUSG00000002668


For any suggestions or comments, please send an email to unitrap@crg.es