Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST152753
Clone ID OST152753
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST152753
Sequence
GACTGAGGAGTCCCTGGCTCCTGCCCCAAACGCATCCTGGACGGGTAACCTCAGAGCTGTGAAGTGGATGGACATGGAAG
CGAAGCATGGAGGCTGCCATGGTAAGNNCTCCCGNTCTGGGGCCACCCTGCCTGTGGCTGACCCAAGACAACTGTANACT
CAGTAAAAGAGGTTCTTG
Sequence Type mRNA
Unitrap ID UNI15894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 41048943..41049117 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021360 (Gcnt2) NM_133219 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme Gene [Source:MGI Symbol;Acc:MGI:1100870]

 
Come back to gene ENSMUSG00000021360


For any suggestions or comments, please send an email to unitrap@crg.es