Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU393
Clone ID RRU393
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU393
Sequence
GGAGTCCGGGAGTGCTGCTCCCTGAGTGTGTGTGGAGCTGGGTGGTGTTTGGTGCGGTACGGCGGCCACTCAGTTGCAG
Sequence Type mRNA
Unitrap ID UNI7184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86118283..86118361 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031708 (1600014K23Rik) NM_134118 glycoprotein, synaptic 2 Gene [Source:MGI Symbol;Acc:MGI:1915408]

 
Come back to gene ENSMUSG00000031708


For any suggestions or comments, please send an email to unitrap@crg.es