Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU481
Clone ID RRU481
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU481
Sequence
AGTACACGGTAGTTGCCCTGTCTTCTTGGATAGAGTTCACGCTCGAGAACATCTTCTGGCCAGAACTGAAGCAGATTACC
TGGCTGAGTGCCACCGGGCTCCTGATGGTGGTCTTCGGAGAATGCCTGAGGAAAGCTGCCATGTTTACGGCTGGCTCCAA
CTTCAACCATGTGGTGCAGAGTGAAAAGTCAGACACCCACACTCTGGTGACAAGTGGGGTGTATGCTTGGTGCCGGCACC
CCTCCTATGTGGGCTGGTTTTACTGGAGTATCGGAAC
Sequence Type mRNA
Unitrap ID UNI7190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151673887..151674859 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039662 (Icmt) NM_133788 isoprenylcysteine carboxyl methyltransferase Gene [Source:MGI (curated);Acc:Icmt-001]

 
Come back to gene ENSMUSG00000039662


For any suggestions or comments, please send an email to unitrap@crg.es