Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU488
Clone ID RRU488
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU488
Sequence
AGTGGTTTGTGCTGTTGATGCGTGGTTATGGGTCGGAGACGAGCGCCGGGTGGTGGGTCCCTGGGCCGAGTACTTATCCG
GCAGCAGACTCAGCGAAGCCGCAGCCACCGTCATACTGACTCCTGGCTGCATACAAGTGAACTCAATGATGGCTATGACT
GGGGTCGTCTGAATCTTCAGTCTGTGACAGAGCAGAGCTCCCTGGAGGACTTTCTTGCAACTGCAGAACTTGCAGGGACC
GAGTTTGTGGCTGAGAAGCTGAATATTAAGTTTGTACCCCCTGAGGCTAGAACCGGACTGCTGTCTTTTGAGGAGAGCCA
GAGAATTAAGAAACTCCACGAAGAAAACAGACAGTTCTTGTGTATACCAAGGAGGCCAAATTGGGACAGAAAAACTAGCC
CAGAAGAACTGAAACAAGCAGAGAAAGATAACTTCCTGAAATGGAGGCGCCAGCTTGTGC
Sequence Type mRNA
Unitrap ID UNI7193

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30582585..30587649 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022538 (Lsg1) NM_178069 large subunit GTPase 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsg1-001]

 
Come back to gene ENSMUSG00000022538


For any suggestions or comments, please send an email to unitrap@crg.es