Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST151740
Clone ID OST151740
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST151740
Sequence
GTGAGTCCAGGAGGGCAAAGGACAGCTCTCATCTGATGAATGGTCCTATATCGCAAACCACTTCTCAAACAAGGTCCCTC
CCAGCTTTGACTCAGGTCCCACCANCTANNGTTTCAGAGCTAACCCCTACTGCANNGGTATGNNGGACTCATATGTNACA
TTTGGAANCGAGTNGNGCAGCTGTTGGTGNGAATGCTGCAGNGAGAAGAGGCTCCCGGNCATNCTNCNNANNGNGACCAG
CANGTTATAGNATTGGANGCCNANGGNGATGGNGACAAAAGTAGNGAGAATGCNTCGCTCCCGGACNCACNGGAGGCNTA
GCAGACAGACTGAGCACTCTGGCTCTGGACCATNCANAATATGAACCTCTGNCTGAGAACAACGATACGGGAGGAAATGA
GCCTNAACCAGAAAGCCGGGAA
Sequence Type mRNA
Unitrap ID UNI15133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9121441..9143031 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es