Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST151739
Clone ID OST151739
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST151739
Sequence
GACTGAGGTACTATTTCNGAACAGGAGAGAAAGGAAAGACCGTTGNTTACCTTGTGGCTTTCCATCTGTTCTTTGTTATG
TTCGTATGGTCTTATNGGNTGACAAAATNCACGGCTCCNGCTAGCCCTTCCAAAGAGCTCTACTTGTCAAACTCTGAGAA
GGAGCGTTNTGAGAAGGAGANCANCCAAGAAAGACAGCAAGACATTTTGAGAAGAGCGGCAAGAGACCTGCCTATCTACA
CCACATCAGCTNCAAAGGCTATCCGATATTGGGAAAAATGTCAGTTGATTAAACCTGACCGAGCCCATCACTGCTCAGCA
TG
Sequence Type mRNA
Unitrap ID UNI9228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58477383..58497298 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021969 (Zdhhc20) NM_029492 zinc finger, DHHC domain containing 20 Gene [Source:MGI Symbol;Acc:MGI:1923215]

 
Come back to gene ENSMUSG00000021969


For any suggestions or comments, please send an email to unitrap@crg.es